Sequence ID | >WENV170652891 |
Genome ID | JRYH01079523 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1345 |
End posion on genome | 1429 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ctcttactgt |
tRNA gene sequence |
GCCCGCATGTTGGAATAGGTAGACAACAGGGACTTAAAATCCCTTGCTTTCGAGCGTGCA |
Downstream region at tRNA end position |
tttaatcttt |
Secondary structure (Cloverleaf model) | >WENV170652891 Leu TAA t ACCA tttaatcttt G - C C - G C - G C - G G - C C - G A - T T G T C G T C C A T A A G | | | | | G A G G T T G C A G G C G | | | T T G A C A A T A G C TGCTTTCGAGCGT A - T G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |