Sequence ID | >WENV170652892 |
Genome ID | JRYH01079548 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 712 |
End posion on genome | 639 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ctccgccaat |
tRNA gene sequence |
TCCGGTCTCGTCTAACGGTAGGACGGCTATTTTTGGGGTAGCTTATGTTGGTTCGAATCC |
Downstream region at tRNA end position |
ttgtccttta |
Secondary structure (Cloverleaf model) | >WENV170652892 Gln TTG t TCCA ttgtccttta T - A C - G C - G G - C G - C T - A C - G T A T C G A C C A A A C | + | | | G C T C T G G T T G G C G + | | | T T G G G A C T A G TTAT G - C C - G T - A A - T T + G T G T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |