Sequence ID | >WENV170652893 |
Genome ID | JRYH01079548 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 637 |
End posion on genome | 563 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ccggatccat |
tRNA gene sequence |
TGTCCTTTAGATTAATTGGTAGATCACTAGACTCTGAATCTAGCAGTGGAGGTTCGAATC |
Downstream region at tRNA end position |
tttgtttata |
Secondary structure (Cloverleaf model) | >WENV170652893 Gln CTG t ACCA tttgtttata T - A G - C T - A C - G C - G T + G T - A T A T C C T C C A T A A A | | | | | G T T T A G G G A G G C G + | | | T T G G A T C T A A CAGT C - G T - A A - T G - C A - T C A T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |