Sequence ID | >WENV170652894 |
Genome ID | JRYH01082044 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1324 |
End posion on genome | 1250 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
nnnnnncgtt |
tRNA gene sequence |
GGCTCCATAGTTTAGTGGTTAGAATACCTGATTTTCACTCAGATGGCACGAGTTCGATCC |
Downstream region at tRNA end position |
cacttagtaa |
Secondary structure (Cloverleaf model) | >WENV170652894 Glu TTC t ACCA cacttagtaa G + T G - C C - G T - A C - G C - G A - T C T T T G C T C A T G A A | | | | | G G T T T G A C G A G C G + | | + T T T G A A T T A A TGGC C A C - G T - A G - C A - T T C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |