Sequence ID | >WENV170652895 |
Genome ID | JRYH01082044 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 655 |
End posion on genome | 582 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ggaaagaaga |
tRNA gene sequence |
AGTCCGTTGGCCAAGTGGAAAGGCAATAGGTTTACACCCTATGATCGTTGGTTCTAACCC |
Downstream region at tRNA end position |
gcttcagaaa |
Secondary structure (Cloverleaf model) | >WENV170652895 Val TAC a ACCA gcttcagaaa A - T G - C T - A C - G C - G G - C T - A C A T C G A C C A G A G | + | | | T T A C C G G T T G G C G | | | T T G A G G C A A A GATC A - T T - A A - T G - C G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |