Sequence ID | >WENV170652896 |
Genome ID | JRYH01083243 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 660 |
End posion on genome | 736 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gcgctcttta |
tRNA gene sequence |
GCCTCTGTAGGCCAATTGGTAGAGTCACTAGATTTAGGATCTAGTCAGTGCAGGTTCGAG |
Downstream region at tRNA end position |
attcttttag |
Secondary structure (Cloverleaf model) | >WENV170652896 Leu TAG a ACCA attcttttag G - C C - G C - G T - A C - G T - A G - C T G T C G T C C A T A A A | | | | | G T C C G G G C A G G C G | + | T T G A G T C T A G A TCAGT C - G T - A A - T G - C A - T T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |