Sequence ID | >WENV170652897 |
Genome ID | JRYH01084089 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 282 |
End posion on genome | 357 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ataacaaaaa |
tRNA gene sequence |
GCGTTCCTAGCTCAATTGGACCAGAGCGAATGGTTTCTACCCATTAGGTTCCGGGTTCGA |
Downstream region at tRNA end position |
agccctcagg |
Secondary structure (Cloverleaf model) | >WENV170652897 Arg TCT a ACat agccctcagg G - C C - G G - C T - A T - A C - G C - G T A T G G T C C A T T A A A | | + | | G G C T C G C C G G G C G | | | | T T A G A G C C C A G AGGTT A - T A - T T - A G - C G - C T C T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |