Sequence ID | >WENV170652898 |
Genome ID | JRYH01086611 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 225 |
End posion on genome | 301 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gttaagagat |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCGCCACCCTCCGAAGGCGGAGGTCAGAGGTTCGAA |
Downstream region at tRNA end position |
acaaattcaa |
Secondary structure (Cloverleaf model) | >WENV170652898 Arg CCG t GCCA acaaattcaa G - C C - G G + T C - G C - G C - G G - C T A T T C T C C A C G A A | | | | | G T C T C G A G A G G C G | | | | T T G G A G C A T A G AGGTC C - G C - G A C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |