Sequence ID | >WENV170652899 |
Genome ID | JRYH01087391 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1206 |
End posion on genome | 1121 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gcactctctt |
tRNA gene sequence |
GCCTGAATCGCATAGTGGTCGATTGCACCTCACTTGTAATGAGGTAGAGAAATCTCACAT |
Downstream region at tRNA end position |
gtgaaagtca |
Secondary structure (Cloverleaf model) | >WENV170652899 Thr TGT t TCAA gtgaaagtca G - C C - G C - G T - A G - C A - T A - T T A T T A T C C A T G A C | | | | | G G T A C G A T A G G C G | | | T T T T T G C C G A A TAGAGAAATCTCAC C - G C - G T - A C - G A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |