Sequence ID | >WENV170652900 |
Genome ID | JRYH01087391 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 982 |
End posion on genome | 906 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
taactaattc |
tRNA gene sequence |
ATTCCGATAGCTCAGTTTGGTAGAGCGCAACTTTTACATAGTTGATGTCCTAGGTTCAAG |
Downstream region at tRNA end position |
taacaaaatt |
Secondary structure (Cloverleaf model) | >WENV170652900 Val TAC c ACTA taacaaaatt A - T T - A T - A C - G C - G G - C A - T C G T G A T C C A T G A A | | | | | A T C T C G C T A G G C T | | | | T T G G A G C G T A G ATGTC C - G A - T A - T C - G T - A T T T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |