Sequence ID | >WENV170652902 |
Genome ID | JRYH01089233 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 559 |
End posion on genome | 635 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tgcgtgccgg |
tRNA gene sequence |
GGCGGAGTAGCTCAGTCGGTTAGAGCAGAGGAATCATAATCCTTGTGTCGGCGGTTCGAA |
Downstream region at tRNA end position |
acgttcccct |
Secondary structure (Cloverleaf model) | >WENV170652902 Met CAT g ACCA acgttcccct G + T G - C C - G G - C G - C A - T G - C T A T C T G C C A T G A A | + | | | G C C T C G G G C G G C G | | | | T T G G A G C T T A A GTGTC G + T A - T G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |