Sequence ID | >WENV170652903 |
Genome ID | JRYH01090564 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 319 |
End posion on genome | 394 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
gctagacatc |
tRNA gene sequence |
GGGGCCGTAGCTCAGTCGGGAGAGCGTCGGGTTTGCAATCCGAAGGTCGCGGGTTCGATT |
Downstream region at tRNA end position |
acaaaggnnn |
Secondary structure (Cloverleaf model) | >WENV170652903 Ala TGC c ACCA acaaaggnnn G - C G - C G + T G - C C - G C - G G - C T T T C G C C C A T G A A | | | | | G C C T C G G C G G G C G | | | | T T G G A G C G A G AGGTC T - A C - G G - C G - C G + T T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |