Sequence ID | >WENV170652904 |
Genome ID | JRYH01091576 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 49 |
End posion on genome | 122 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
tagataatct |
tRNA gene sequence |
GGGGCAATGTTGTAATGGTAGCAAATCGGATTGTCGATCCGCCAGTACGAGTTCAATTCT |
Downstream region at tRNA end position |
aataaattag |
Secondary structure (Cloverleaf model) | >WENV170652904 Asp GTC t GCCA aataaattag G + T G - C G - C G - C C - G A - T A A T T T T G C T C A A A G | | | | | A T T G T T A C G A G C G + | | | T T G G C A A T A A CAGT T C C - G G - C G - C A - T T A T G G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |