Sequence ID | >WENV170652905 |
Genome ID | JRYH01092109 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 175 |
End posion on genome | 100 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tacatctatg |
tRNA gene sequence |
GCTGGCATAGCTCAGTTGGAAGAGTGCTTGATTTGTAATGAAGATGTCGCGGGTTCGACT |
Downstream region at tRNA end position |
agttgacaca |
Secondary structure (Cloverleaf model) | >WENV170652905 Thr TGT g ACCA agttgacaca G - C C - G T - A G - C G - C C - G A - T T C T C G T C C A T G A A | | + | | G T C T C G G C G G G C G | | | + T T G G A G T A A G ATGTC C - G T - A T - A G G A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |