Sequence ID | >WENV170652906 |
Genome ID | JRYH01093371 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 382 |
End posion on genome | 307 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tgctatataa |
tRNA gene sequence |
AGGCCCGTAGCCAAGCGGTTAAGGCCGGCTGTTCATAACAGTCTGACCGCCGGTTCGAAT |
Downstream region at tRNA end position |
ctacccgcac |
Secondary structure (Cloverleaf model) | >WENV170652906 Met CAT a CCCC ctacccgcac A - T G - C G - C C - G C - G C - G G - C T A T C G G C C A C G A A | | | | | G G A C C G G C C G G C G | | | T T T A G G C T A C TGACC G - C G + T C - G T - A G - C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |