Sequence ID | >WENV170652911 |
Genome ID | JRYH01095440 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 241 |
End posion on genome | 168 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
cacagcgtga |
tRNA gene sequence |
TCCCCGATCGTCTAATGGTAGGACAACAGACTCTGAATCTGTGAATCGTGGTTCGAATCC |
Downstream region at tRNA end position |
tctcgattcc |
Secondary structure (Cloverleaf model) | >WENV170652911 Gln CTG a TCCA tctcgattcc T - A C - G C - G C - G C - G G - C A - T T A T G C A C C A A A C | | | | | G T T C T G C G T G G C G + | | | T T G G G A C T A A GAAT A - T C - G A - T G - C A - T C A T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |