Sequence ID | >WENV170652915 |
Genome ID | JRYH01099590 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 263 |
End posion on genome | 193 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
caataatcac |
tRNA gene sequence |
GCGACATTGGTGAAGTGGTCTCACGGTAGAATGCCAATCTACAGTCATCAGTTCGATTCT |
Downstream region at tRNA end position |
gcgtgtaaat |
Secondary structure (Cloverleaf model) | >WENV170652915 Gly GCC c Aatg gcgtgtaaat G - C C - G G - C A - T C - G A - T T - A T T T T A G T C A G A G | | | | | G T A G T G A T C A G C G | | | | T T G T C A C T C G AGTC G - C T - A A - T G - C A - T A A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |