Sequence ID | >WENV170652916 |
Genome ID | JRYH01101107 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 111 |
End posion on genome | 37 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ttcacggtca |
tRNA gene sequence |
GCCGGCGTAGCTCAGCGGTAGTGCATCCGCTTCGTAAGCGGGTGGTCGGGGGTTCAAATC |
Downstream region at tRNA end position |
cccttcgcgg |
Secondary structure (Cloverleaf model) | >WENV170652916 Thr CGT a ACCA cccttcgcgg G - C C - G C - G G - C G - C C - G G - C T A T C T C C C A G A A | + | | | A C C T C G G G G G G C G | | | T T G G T G C T A A TGGTC T + G C - G C - G G - C C - G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |