Sequence ID | >WENV170652917 |
Genome ID | JRYH01101217 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1317 |
End posion on genome | 1241 |
Amino Acid | Sup |
Anticodon | CTA |
Upstream region at tRNA start position |
attctttttt |
tRNA gene sequence |
GTCTCCATCGTATAATGGGCAAGTACACTGGTCTCTAAAACTATGAGGAGTGGGTTCGAG |
Downstream region at tRNA end position |
ttgcaatatt |
Secondary structure (Cloverleaf model) | >WENV170652917 Sup CTA t ACCA ttgcaatatt G - C T - A C - G T - A C - G C - G A - T T G T C A C C C A T A A C | | | | | G G T A T G G T G G G C G + | | | T T G G T A C C A A A GAGGA C T T - A G + T G - C T - A C A T A C T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |