Sequence ID | >WENV170652919 |
Genome ID | JRYH01102331 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 131 |
End posion on genome | 207 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
caccttaaat |
tRNA gene sequence |
GCCCGGGTCGCCAAGTGGTTTAAGGCATCGGTTTTACACGCCGACATGCGCAGGTTCGAA |
Downstream region at tRNA end position |
cattttatgc |
Secondary structure (Cloverleaf model) | >WENV170652919 Val TAC t ACCA cattttatgc G + T C - G C - G C - G G - C G - C G - C C A T C G T C C A T G A C | | | | | G G A C C G G C A G G C G | | | T T T A G G C T T A A CATGC T - A C - G G - C G - C T + G T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |