Sequence ID | >WENV170652920 |
Genome ID | JRYH01105152 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 93 |
End posion on genome | 20 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
cgcgcatcgg |
tRNA gene sequence |
GGCCCGATGGCGGAGTGGTTACGCAGAGGACTGCAAATCCTTGCACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
aaatcctgtt |
Secondary structure (Cloverleaf model) | >WENV170652920 Cys GCA g TCCA aaatcctgtt G - C G - C C - G C - G C - G G - C A - T T T T C G G C C A G A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T T A GCAC G + T A - T G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |