Sequence ID | >WENV170652921 |
Genome ID | JRYH01106524 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 175 |
End posion on genome | 251 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
agtgtttagt |
tRNA gene sequence |
GCGCCTGTAGACCAATTGGTAGAGTCAAGAAACTTAAAATTTCTGTGTTGCGAGTTCGAA |
Downstream region at tRNA end position |
aacactaata |
Secondary structure (Cloverleaf model) | >WENV170652921 Leu TAA t ACTA aacactaata G - C C - G G - C C - G C - G T + G G - C C A T C G C T C A T A A A | | | | | G T C C A G G C G A G C G | | | T T G A G T C T A G A GTGTT A - T G - C A - T A - T A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |