Sequence ID | >WENV170652922 |
Genome ID | JRYH01106838 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1 |
End posion on genome | 77 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
CGGGGTGTAGCGCAGTCTGGTAGCGCGCGGCGCTTGGGACGCCGAAGTCGGAGGTTCGAG |
Downstream region at tRNA end position |
ttttgtgcat |
Secondary structure (Cloverleaf model) | >WENV170652922 Pro TGG n ACCA ttttgtgcat C - G G - C G - C G - C G - C T - A G - C C G T T C T C C A T G A A + | | | | G C C G C G G G A G G C T | | | | T T G G C G C G T A G AAGTC C - G G - C G - C C - G G - C C A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |