Sequence ID | >WENV170652923 |
Genome ID | JRYH01107079 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 232 |
End posion on genome | 316 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gcggcgtgaa |
tRNA gene sequence |
GGGAGAGTGTCCCGAGCGGCAAAGGGGGCGGACTGTAAATCCGCTGGCTATGCCTTCGTA |
Downstream region at tRNA end position |
ttctgctccg |
Secondary structure (Cloverleaf model) | >WENV170652923 Tyr GTA a ACCA ttctgctccg G - C G - C G - C A - T G - C A - T G A T G T C A T C C A G A G G | | | | | G C C C C T G T A G G C G | | + T T G A G G G C A A G TGGCTATGCCTTC G - C C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |