Sequence ID | >WENV170652929 |
Genome ID | JRYH01114730 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 7 |
End posion on genome | 83 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
nnnnacttcc |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCGCTGCCCTCCGGAGGCAGAGGTCAGGGGTTCGAA |
Downstream region at tRNA end position |
tcttcgatgc |
Secondary structure (Cloverleaf model) | >WENV170652929 Arg CCG c GCCA tcttcgatgc G - C C - G G - C C - G C - G C - G G - C T A T T T C C C A C G A A | + | | | G T C T C G A G G G G C G | | | | T T G G A G C A T A G AGGTC C - G T - A G - C C - G C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |