Sequence ID | >WENV170652934 |
Genome ID | JRYH01121135 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 249 |
End posion on genome | 176 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ccgtccattt |
tRNA gene sequence |
TGTCCGATGGTGTAACTGGCAACACGTCTGGTTTTGGTCCTGAAGAGTCTAGGTTCGAGC |
Downstream region at tRNA end position |
ttttgcccta |
Secondary structure (Cloverleaf model) | >WENV170652934 Gln TTG t ACtt ttttgcccta T - A G - C T - A C - G C - G G - C A - T C G T G A T C C A C A A G | | | | | G T T G T G C T A G G C G | | | | T T G A C A C C A G AGAGT T - A C - G T T G - C G - C T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |