Sequence ID | >WENV170652935 |
Genome ID | JRYH01121646 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 333 |
End posion on genome | 416 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cttggccagc |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCACTACCTTGAGGTGGTAGCGGCTTCGGTCGTGGG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170652935 Leu GAG c ACCn nnnnnnnnnn G - C C - G C - G C - G A - T G + T G - C T G T C C C C C A T A A G | | | | | G T G G C G G G G G G C G | | | T T G A C G C T A G A CGGCTTCGGTCGT C - G T - A A - T C - G C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |