Sequence ID | >WENV170652939 |
Genome ID | JRYH01127656 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 158 |
End posion on genome | 83 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
catcttcccc |
tRNA gene sequence |
GGGTCCTTAGCTCAGCCGGTAGAGCGCCTCGTTCACATCGAGGAGGTCGCCAGTTCGAAC |
Downstream region at tRNA end position |
tcacccctcg |
Secondary structure (Cloverleaf model) | >WENV170652939 Val CAC c ACCA tcacccctcg G - C G - C G - C T - A C - G C - G T - A C A T C G G T C A C G A A | | | | | G C C T C G G C C A G C G | | | | T T G G A G C T A G AGGTC C - G C - G T - A C - G G - C T T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |