Sequence ID | >WENV170652941 |
Genome ID | JRYH01129784 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 152 |
End posion on genome | 225 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gttttacatt |
tRNA gene sequence |
GCCCTCGTAGTATAATGGTATTACGTTTCTTTGGTAAGGAAAAGAAGAAGGTTCAATTCC |
Downstream region at tRNA end position |
tatatgagga |
Secondary structure (Cloverleaf model) | >WENV170652941 Thr GGT t TCCA tatatgagga G - C C - G C - G C - G T T C T G - C T T T C T T C C A A A A | | | | | A T T A T G G A A G G C G | | | T T G T T A C T A G AGAA T - A T - A T - A C - G T + G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |