Sequence ID | >WENV170652942 |
Genome ID | JRYH01133412 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 82 |
End posion on genome | 6 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
cgtctggtca |
tRNA gene sequence |
CGGAGTGTAGCGCAGCCTGGTAGCGCACATCGTTCGGGACGATGGGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
gaaaannnnn |
Secondary structure (Cloverleaf model) | >WENV170652942 Pro CGG a ACCA gaaaannnnn C - G G - C G - C A - T G - C T - A G - C T A T C G T C C A C G A A | | | | | A C C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC C - G A - T T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |