Sequence ID | >WENV170652943 |
Genome ID | JRYH01134764 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 215 |
End posion on genome | 143 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gatatttttt |
tRNA gene sequence |
GGACTCGTAGTTCAATGGATAGAATAGAAGTTTCCTAAACTTTTGATGCAGGTTCGATTC |
Downstream region at tRNA end position |
ttagacttcc |
Secondary structure (Cloverleaf model) | >WENV170652943 Arg CCT t ACtt ttagacttcc G + T G - C A G C - G T - A C - G G - C T T T C G T T C A T A A A | | | + | G G C T T G G C A G G C G | | | + T T A G A A T T A A TGAT G + T A - T A - T G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |