Sequence ID | >WENV170652944 |
Genome ID | JRYH01135047 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 677 |
End posion on genome | 601 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tcgaaggaaa |
tRNA gene sequence |
GGCTACGTAGCTCAGTCGGTTAGAGCGGCAGAATCATAATCTGTAGGTCCGGGGTTCGAA |
Downstream region at tRNA end position |
aatcttggct |
Secondary structure (Cloverleaf model) | >WENV170652944 Met CAT a ACCA aatcttggct G - C G - C C - G T - A A - T C - G G - C T A T G T C C C A T G A A | + | | | G C C T C G C G G G G C G | | | | T T G G A G C T T A G AGGTC G + T C - G A - T G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |