Sequence ID | >WENV170652945 |
Genome ID | JRYH01135074 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 232 |
End posion on genome | 306 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
ttttaacaat |
tRNA gene sequence |
CGGGGTGTGGCGCAGTTGGTTAGCGTACACGTCTGGGGGGCGTGTGGTCGCTGGTTCGAG |
Downstream region at tRNA end position |
aagaaacctc |
Secondary structure (Cloverleaf model) | >WENV170652945 Pro GGG t ACac aagaaacctc C - G G - C G - C G - C G - C T - A G - C T G T T G A C C A T G A G + | | | | G T C G C G G C T G G C G | | | + T T G G C G T T T A A TGGTC C - G A - T C - G G - C T + G C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |