Sequence ID | >WENV170652946 |
Genome ID | JRYH01135266 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 247 |
End posion on genome | 323 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
gtattgattt |
tRNA gene sequence |
CGGGGTGTAGCTCAGCCTGGTAGAGCACTGCTTTCGGGAGGCAGGGGCCGTAGGTTCAAA |
Downstream region at tRNA end position |
tttaaatcaa |
Secondary structure (Cloverleaf model) | >WENV170652946 Pro CGG t ACCA tttaaatcaa C - G G - C G - C G - C G - C T - A G - C T A T T A T C C A C G A A + | | | | A C C T C G G T A G G C T | | | | T T G G A G C G T A A GGGCC C - G T - A G - C C - G T + G T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |