Sequence ID | >WENV170652948 |
Genome ID | JRYH01137333 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 222 |
End posion on genome | 147 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ttagcacgag |
tRNA gene sequence |
GCCGCAGTAACTCAGTTGGTAGAGTAGCTGATTCGTAATCAGCAAGTCGGAGGTTCGACT |
Downstream region at tRNA end position |
cgactttgta |
Secondary structure (Cloverleaf model) | >WENV170652948 Thr CGT g ACCA cgactttgta G - C C - G C - G G - C C - G A - T G - C T C T T C T C C A T G A A + | | | | G T C T C A G G A G G C G | | | | T T G G A G T T A A AAGTC G - C C - G T - A G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |