Sequence ID | >WENV170652950 |
Genome ID | JRYH01138596 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 163 |
End posion on genome | 238 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ccaatttcat |
tRNA gene sequence |
TGCCATGTATCCTAATTGGTAAGGAGGCGCACTGTTAATGCGTAATATGCAGGTTCGAGT |
Downstream region at tRNA end position |
tttcgatgct |
Secondary structure (Cloverleaf model) | >WENV170652950 Asn GTT t GCCA tttcgatgct T - A G - C C - G C - G A - T T T G - C T G T C G T C C A T A A A | | | | | G T T C C T G C A G G C G | | | | T T G A G G A T A G AATAT G + T C - G G - C C - G A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |