Sequence ID | >WENV170652952 |
Genome ID | JRYH01138946 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 169 |
End posion on genome | 96 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
acccgcacat |
tRNA gene sequence |
TGAGACATAGTGTAGCGGTAACACACAAGACTTTGACTCTTGTATCATAGGTTCGAATCC |
Downstream region at tRNA end position |
aaaatggtgt |
Secondary structure (Cloverleaf model) | >WENV170652952 Gln TTG t ACAA aaaatggtgt T - A G - C A - T G - C A - T C - G A - T T A T T T T C C A G A A | | | | G C T G T G A T A G G C G | | | | T T G A C A C T A A TATC C - G A - T A - T G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |