Sequence ID | >WENV170652959 |
Genome ID | JRYH01148601 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 264 |
End posion on genome | 340 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aaagtttatt |
tRNA gene sequence |
CTCTGTGTAGCTGAGCTTGGTTGTAGCACGCCGTTTGGGGCGGCGAGACGGGGGTTCGAA |
Downstream region at tRNA end position |
ttttacctga |
Secondary structure (Cloverleaf model) | >WENV170652959 Pro TGG t ACCA ttttacctga C - G T - A C - G T + G G - C T - A G - C T A T C T C C C A T C G A A | + | | | G T G T C G G G G G G C G + | | | T T G T A G C T T G A AGAC C - G G - C C - G C - G G - C T G T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |