Sequence ID | >WENV170652960 |
Genome ID | JRYH01149844 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 51 |
End posion on genome | 124 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gtcactccat |
tRNA gene sequence |
GGGCGATTGATGTAATGGAAGCCTGTCTGTTTTACATGCAGAATGCGAAAGTTCGATTCT |
Downstream region at tRNA end position |
atcattacaa |
Secondary structure (Cloverleaf model) | >WENV170652960 Val TAC t ACCA atcattacaa G + T G - C G - C C - G G - C A - T T - A T T T C T T T C A A A G | | | | | G T T G T A G A A A G C G + | | T T G G C C T A A G ATGC T - A C - G T - A G - C T + G T T T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |