Sequence ID | >WENV170652961 |
Genome ID | JRYH01150873 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 13 |
End posion on genome | 104 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tttacagttt |
tRNA gene sequence |
TGAGAGATTGCAGAGCGGTTGAATTCGGCGGTCTTGAAAACCGTTATTCCGTGAGAACGG |
Downstream region at tRNA end position |
gacttcatta |
Secondary structure (Cloverleaf model) | >WENV170652961 Ser TGA t TCCA gacttcatta T C G - C A - T G - C A - T G - C A - T T A T C A C C C A C G A T | | | | | G G G A C G G T G G G C G | | T T T A T T C T G A G TATTCCGTGAGAACGGGATC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |