Sequence ID | >WENV170652962 |
Genome ID | JRYH01152924 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 74 |
End posion on genome | 1 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cgcaccggct |
tRNA gene sequence |
GCCGGCTTAGCACAGTGGTAGTGCACCTGATTTGTAATCAGGGGGTCGTAGGTTCAAATC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170652962 Thr TGT t ACCn nnnnnnnnnn G - C C - G C - G G - C G - C C - G T - A T A T C A T C C A G A A | | | | | A T C A C G G T A G G C G | | | | T T G G T G C T A A GGGTC C - G C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |