Sequence ID | >WENV170658929 |
Genome ID | JUGB01000198 |
Phylum/Class | [JUGB] scorpion gut metagenome; ten pooled guts of food-deprived Vaejovis mexicanus smith and Centruroides limpidus |
Species | |
Start position on genome | 1985 |
End posion on genome | 2059 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ctcagtcggg |
tRNA gene sequence |
GCCGCCGTAGCTCAGTGGTAGAGCGCATCCTTGGTAAGGCTGAGGTCGTGGGTTCGATTC |
Downstream region at tRNA end position |
tctgagaact |
Secondary structure (Cloverleaf model) | >WENV170658929 Thr GGT g ACCA tctgagaact G - C C - G C - G G - C C - G C - G G - C T T T C C C C C A G A A | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A G AGGTC C - G A - T T C C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |