Sequence ID | >WENV170658939 |
Genome ID | JUGB01000721 |
Phylum/Class | [JUGB] scorpion gut metagenome; ten pooled guts of food-deprived Vaejovis mexicanus smith and Centruroides limpidus |
Species | |
Start position on genome | 358 |
End posion on genome | 434 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aaagtcttcc |
tRNA gene sequence |
GGGTCTGTAGCTCAGGTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGTAGTTCGAG |
Downstream region at tRNA end position |
ttctctgaat |
Secondary structure (Cloverleaf model) | >WENV170658939 Ile GAT c ACCA ttctctgaat G - C G - C G - C T - A C - G T - A G - C T G T C C A T C A G G A A | | | | | G T C T C G G G T A G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |