Sequence ID | >WENV170658946 |
Genome ID | JUGB01000854 |
Phylum/Class | [JUGB] scorpion gut metagenome; ten pooled guts of food-deprived Vaejovis mexicanus smith and Centruroides limpidus |
Species | |
Start position on genome | 2189 |
End posion on genome | 2114 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
accctgagat |
tRNA gene sequence |
GGGGCCATAGCTCAGTTGGTAGAGCGCCTGCTTTGCAAGCAGGATGTCGTCGGTTCGACT |
Downstream region at tRNA end position |
ggccgccccg |
Secondary structure (Cloverleaf model) | >WENV170658946 Ala TGC t ACCA ggccgccccg G - C G - C G + T G - C C - G C - G A - T T C T C T G C C A T G A A | | | | G T C T C G G T C G G C G | | | | T T G G A G C T A G ATGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |