Sequence ID | >WENV170658947 |
Genome ID | JUGB01001150 |
Phylum/Class | [JUGB] scorpion gut metagenome; ten pooled guts of food-deprived Vaejovis mexicanus smith and Centruroides limpidus |
Species | |
Start position on genome | 2045 |
End posion on genome | 1970 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
nnnnnnnngc |
tRNA gene sequence |
GCCTGGATAGCTCAGCTGGTAGAGCAGCGGATTGAAAATCCGCGTGTCGGTGGTTCGAAC |
Downstream region at tRNA end position |
tctctcaacg |
Secondary structure (Cloverleaf model) | >WENV170658947 Phe GAA c ACCA tctctcaacg G - C C - G C - G T - A G - C G - C A - T C A T C C G C C A C G A A | | + | | G T C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G - C C - G G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |