Sequence ID | >WENV170658951 |
Genome ID | JUGB01001479 |
Phylum/Class | [JUGB] scorpion gut metagenome; ten pooled guts of food-deprived Vaejovis mexicanus smith and Centruroides limpidus |
Species | |
Start position on genome | 1741 |
End posion on genome | 1665 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
nnnnnnnggt |
tRNA gene sequence |
GCGTCCTTAGCTCAGTTGGTTAGAGCATCTGACTTTTAATCAGAGGGTCCTCGGTTCGAG |
Downstream region at tRNA end position |
ttcctccttt |
Secondary structure (Cloverleaf model) | >WENV170658951 Lys TTT t ACCA ttcctccttt G + T C - G G - C T - A C - G C - G T - A C G T G A G C C A T G A A | | | | | G T C T C G C T C G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |