Sequence ID | >WENV170658952 |
Genome ID | JUGB01001554 |
Phylum/Class | [JUGB] scorpion gut metagenome; ten pooled guts of food-deprived Vaejovis mexicanus smith and Centruroides limpidus |
Species | |
Start position on genome | 1107 |
End posion on genome | 1032 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
cgatcggtgt |
tRNA gene sequence |
GGGTGATTAGCTCAGTCGGTAGAGCAGCTGACTCTTAATCAGCGGGTCCACAGTTCGAAC |
Downstream region at tRNA end position |
tcgtctttct |
Secondary structure (Cloverleaf model) | >WENV170658952 Lys CTT t ACCA tcgtctttct G - C G - C G - C T - A G - C A - T T - A C A T G T G T C A T G A A | | | | | G C C T C G C A C A G C G | | | | T T G G A G C T A A GGGTC G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |