Sequence ID | >WENV170658958 |
Genome ID | JUGB01002008 |
Phylum/Class | [JUGB] scorpion gut metagenome; ten pooled guts of food-deprived Vaejovis mexicanus smith and Centruroides limpidus |
Species | |
Start position on genome | 575 |
End posion on genome | 486 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ctggcgacat |
tRNA gene sequence |
GGACAGGTGGCGGAGTGGTCGATCGCGCACGCTTGGAAAGCGTGTGTAGGTGAAAGCCTA |
Downstream region at tRNA end position |
ttcgctttga |
Secondary structure (Cloverleaf model) | >WENV170658958 Ser GGA t GCCA ttcgctttga G - C G - C A - T C - G A - T G - C G + T T A T C T C C C A T G A G | | | | | G G G G C G G A G G G C G + | | | T T T T C G C C G A G TGTAGGTGAAAGCCTACC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |