Sequence ID | >WENV170658959 |
Genome ID | JUGB01002058 |
Phylum/Class | [JUGB] scorpion gut metagenome; ten pooled guts of food-deprived Vaejovis mexicanus smith and Centruroides limpidus |
Species | |
Start position on genome | 529 |
End posion on genome | 453 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ccgttcggtc |
tRNA gene sequence |
CGGGGTGTAGCGCAGCCTGGTAGCGCATCTGGTTTGGGACCAGAGGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
acggaaggcc |
Secondary structure (Cloverleaf model) | >WENV170658959 Pro TGG c ACCA acggaaggcc C - G G - C G - C G - C G - C T + G G - C T A T T C T C C A C G A A + | | | | G C C G C G G G A G G C T | | | | T T G G C G C G T A A GGGTC T - A C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |