Sequence ID | >WENV170658960 |
Genome ID | JUGB01002109 |
Phylum/Class | [JUGB] scorpion gut metagenome; ten pooled guts of food-deprived Vaejovis mexicanus smith and Centruroides limpidus |
Species | |
Start position on genome | 610 |
End posion on genome | 536 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
aagcaaaatc |
tRNA gene sequence |
GGGCGGTTAGCTCAGCGGTAGAGCACTACCTTGACATGGTAGGGGTCACAGGTTCGAACC |
Downstream region at tRNA end position |
cctggctccc |
Secondary structure (Cloverleaf model) | >WENV170658960 Val GAC c ACCA cctggctccc G - C G - C G - C C - G G - C G - C T - A C A T T G T C C A G A A | | | | | G C C T C G A C A G G C G | | | | T T G G A G C T A A GGGTC C - G T - A A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |